Archives
- August 2008 (7)
- July 2008 (2)
- May 2008 (2)
- April 2008 (3)
- March 2008 (1)
- November 2007 (2)
- October 2007 (3)
- September 2007 (43)
Authors
Sections
Sandpit Group
- Demo At Southampton (1)
- DrexelDemo (5)
- UsefulChem Mashup (1)
- Usefulchem Exp098 (24)
- Ahm2007 (16)
- Davederouredemo (3)
- Screencast (6)
Analysis Result
- NMR (15)
Procedure Type
- NMR (1)
- NMR 1H (1)
- PCR Reaction (9)
- Electrophoresis Agarose (4)
- Test (1)
- Thermal Cycler Programme (2)
Dna
- Marker (1)
- Oligonucleotide (3)
- Pcr Product (5)
- Plasmid (2)
Enzyme
- Polymerase (1)
Buffer
- Polymerase (2)
Tools
Show/Hide Keys
Procedure Type: electrophoresis_agarose
Sandpit Group: screencast
An agarose gel was made up with 0.4 g of agarose in 20 mL of TAE buffer. The gel was run at a voltage of 80 V for approximately 45 minutes. Samples were made up with at least 1/6th volume gel loading buffer.
A 0.7% agarose gel was run in TAE buffer at 80V for ~45 minutes, stained in ethidum bromide and then destained in tap water. The gel was imaged under UV illumination.
Sandpit Group: screencast
An agarose gel was made up with 0.4 g of agarose in 20 mL of TAE buffer. The gel was run at a voltage of 80 V for approximately 45 minutes. Samples were made up with at least 1/6th volume gel loading buffer.
Lane | Sample | ul |
1 | 1 kb DNA ladder | 5 |
2 | ||
3 | Screencast PCR product | 5 |
4 | Screencast PCR product 2 | 5 |
A 0.7% agarose gel was run in TAE buffer at 80V for ~45 minutes, stained in ethidum bromide and then destained in tap water. The gel was imaged under UV illumination.
Procedure Type: PCR_reaction
Sandpit Group: screencast
PCR reactions were run using the following sample conditions.
The thermalcycler programme was Cameron's thermocycler programme
Sandpit Group: screencast
PCR reactions were run using the following sample conditions.
The thermalcycler programme was Cameron's thermocycler programme
Reaction | Template | uL | Primer 1 | ul | Primer 2 | uL | Buffer | uL | Enzyme | uL | dNTP | ul | Mg | uL | Water (uL) | Product |
1 | pCM862 | 4 | Screencast primer | 4 | SOT015 primer | 4 | Promega taq buffer 12/05/07 | 5 | Promega Taq 11/09/07 | 1 | Screencast PCR product | |||||
2 | pLLC066 | 4 | Screencast primer | 4 | SOT015 primer | 4 | Promega taq buffer 12/05/07 | 5 | Promega Taq 11/09/07 | 1 | Screencast PCR product 2 |
Linked Posts
This post is linked by:
Procedure Type: PCR_reaction
Sandpit Group: screencast
PCR reactions were run using the following sample conditions.
The thermalcycler programme was
Sandpit Group: screencast
PCR reactions were run using the following sample conditions.
The thermalcycler programme was
Reaction | Template | uL | Primer 1 | ul | Primer 2 | uL | Buffer | uL | Enzyme | uL | dNTP | ul | Mg | uL | Water (uL) | Product |
1 | pCM862 | 1 | Screencast primer | 4 | SOT015 primer | 4 | Promega taq buffer 12/05/07 | 5 | Promega Taq 11/09/07 | 1 | dntp | 1 | MgCl2 | 2 | 48 | Screencast PCR product |
2 | ||||||||||||||||
3 | ||||||||||||||||
4 |
Dna: oligonucleotide
Sandpit Group: screencast
Sandpit Group: screencast
| Name | Screencast primer |
| Sequence | atcgggctagctagactgacgactgacgactacgat |
| Melting temp | 70 |
| Supplier | Sigma |
Linked Posts
This post is linked by:
Procedure Type: PCR_reaction
Sandpit Group: Demo_at_Southampton
PCR reactions were run using the following sample conditions.
The thermalcycler programme was Different thermal cycler programme
Sandpit Group: Demo_at_Southampton
PCR reactions were run using the following sample conditions.
The thermalcycler programme was Different thermal cycler programme
Reaction | Template | uL | Primer 1 | ul | Primer 2 | uL | Buffer | uL | Enzyme | uL | dNTP | ul | Mg | uL | Water (uL) | Product |
1 | pCM862 | SOT015 primer | SOT015 primer |