Sortase Cloning

 

Note About: Tus-Tweezers_experiment
In November I am doing an experiment with Andy Ward at the LSF where our aim is to do single molecule studies of Tus binding to its cognate DNA binding site Ter using laser tweezers. The experimental design involves having Tus on one bead, attached using the methodology we described in our PLoS ONE paper PMID: 18000537. The DNA will be attached to a second bead via biotin.

We need a long linker between bead and Ter site so it is far enough away from the bead that we stand some chance of bringing the two beads together. My intention for this is to use the approach that has been used by van Oijen's group in their work using beads attached via DNA linker to a solid surface e.g. PMID: 16452983.

This process is described in most of their papers as 'The forked DNA substrate was made by annealing and ligating the following oligodeoxynucleotides to λ-phage DNA'. A more detailed version is given in Supplementary information for PMID: 12947199 as follows:

"The oligonucleotides and the λ phage DNA are first phosphorylated by means of T4 polynucleotide kinase (New England Biolabs). The λ phage DNA (10^-8 M, 50 μL) and Oligo 1 (10^-7 M) are hybridized (cooled from 55 °C over 1 h) and then ligated (1 Weiss Unit of T4 ligase, New England Biolabs, 16 °C, 2 h). The resulting construct is hybridized (as before) with Oligos 2 and 3 (both 10^-6 M) and ligated (as before). The construct can be stored at 4 °C for several weeks. The presence of T4 ligase in the solution (1 Weiss Unit) minimizes nicking of the DNA."

but the phosphorylation step is not mentioned elsewhere. Another approach is described at http://biocurious.com/labeling-l-dna but I think the ligation approach will be cleaner and easier.

So I will use the oligo described in the Science Paper as the biotinylation strand:

5'-Agg TCg CCg CCC AAA AAA AAA AAA AAA AAA AA-biotin-3'

At the other end we want a Ter site similar to that used in our 2000 Biochemistry paper PMID: 11009613. So two oligos for that:

5'- ATAAGTATGTTGTAACTAAAG
5'- ggg Cgg CgA CCT CTTTAGTTACAACATACTTAT

and as the point of doing the experiment is to compare orientations we also need:

5'-CTTTAGTTACAACATACTTAT
5'- ggg Cgg CgA CCTATAAGTATGTTGTAACTAAAG

Instrument: Mettler_4_place_balance
Project: usefulchem_solubility
Post Type: Weighing
The following samples were weighed on a balance tared to zero with a holder in place. i.e. the weight reported is the weight of the sample and the container or tube it is held in.

Sample	Recorded weight (g)
Dried solution of boc-Gly in methanol	1.2063
Dried solution of gly-Ome from methanol	1.0730
Dried solution of vanillin from methanol	1.0799
Dried solution of glucose from methanol	1.0535
Dried solution ofmannitol from methanol	1.0534
Dried solution of NaCl from methanol	1.0513
Dried solution of boc-Gly from ethanol	1.1757
Dried solution of gly-OMe from ethanol	1.0546
Dried solution of vanillin from ethanol	1.1232
Dried solution of glucuse from ethanol	1.0532
Dried solution of mannitol from ethanol	1.0491
Dried solution of NaCl from ethanol	1.0597
Dried solution of boc-Gly from THF	1.1722
Dried solution of gly-Ome from THF	1.0547
Dried solution of vanillin from THF	1.1673
Dried solution of glucose from THF	1.0500
Dried solution of mannitol from THF	1.0492
Dried solution of NaCl in THF	1.0530

Instrument: Mettler_4_place_balance
Project: usefulchem_solubility
Post Type: Weighing
The following samples were weighed on a balance tared to zero with a holder in place. i.e. the weight reported is the weight of the sample and the container or tube it is held in.

Sample	Recorded weight (g)
Tube 10713	1.0521
Tube 10714	1.0494
Tube 10715	1.0523
Tube 10716	1.0517
Tube 10717	1.0532
Tube 10718	1.0492
Tube 10719	1.0507
Tube 10720	1.0503
Tube 10721	1.0471
Tube 10722	1.0530
Tube 10723	1.0490
Tube 10724	1.0597
Tube 10725	1.0513
Tube 10726	1.0540
Tube 10727	1.0488
Tube 10728	1.0488
Tube 10729	1.0433
Tube 10731	1.0522

Project: usefulchem_solubility

Sample #	Saturated Solution	Tube	Product
1	Saturated solution of boc-Gly in methanol	Tube 10713	Dried solution of boc-Gly in methanol
2	Saturated solution of gly-OMe in methanol	Tube 10714	Dried solution of gly-Ome from methanol
3	Saturated solution of vanillin in methanol	Tube 10715	Dried solution of vanillin from methanol
4	Saturated solution of glucose in methanol	Tube 10716	Dried solution of glucose from methanol
5	Saturated solution of mannitol in methanol	Tube 10717	Dried solution ofmannitol from methanol
6	Saturated solution of NaCl in methanol	Tube 10718	Dried solution of NaCl from methanol
7	Saturated solution of boc-gly in ethanol	Tube 10719	Dried solution of boc-Gly from ethanol
8	Saturated solution of gly-OMe in ethanol	Tube 10720	Dried solution of gly-OMe from ethanol
9	Saturated solution of vanillin in ethanol	Tube 10721	Dried solution of vanillin from ethanol
10	Saturated solution of glucose in ethanol	Tube 10722	Dried solution of glucuse from ethanol
11	Saturated solution of mannitol in ethanol	Tube 10723	Dried solution of mannitol from ethanol
12	Saturated solution of NaCl in ethanol	Tube 10724	Dried solution of NaCl from ethanol
13	Saturated solution of boc-Gly in THF	Tube 10725	Dried solution of boc-Gly from THF
14	Saturated solution of gly-OMe in THF	Tube 10726	Dried solution of gly-Ome from THF
15	Saturated solution of vanillin in THF	Tube 10727	Dried solution of vanillin from THF
16	Saturated solution of Glucose in THF	Tube 10728	Dried solution of glucose from THF
17	Saturated solution of mannitol in THF	Tube 10729	Dried solution of mannitol from THF
18	Saturated solution of NaCl in THF	Tube 10731	Dried solution of NaCl in THF

The saturated solutions (200 uL) as given were transferred to the specified, pre-weighed tubes. These solutions were then dried by speedevac for approximately 2.5 hours to give the dry products as given.

The solution of boc-Gly in ethanol dried to give a gel


The full log of the experiment is available at:

http://usefulchem.wikispaces.com/exp207

Sample #	Solid	Solvent	Product
1	boc-Glycine	Methanol
2	Glycine-OMe	Methanol	Saturated solution of gly-OMe in methanol
3	Vanillin	Methanol	Saturated solution of vanillin in methanol
4	Glucose	Methanol	Saturated solution of glucose in methanol
5	Mannitol	Methanol	Saturated solution of mannitol in methanol
6	NaCl	Methanol	Saturated solution of NaCl in methanol
7	boc-Glycine	Ethanol	Saturated solution of boc-gly in ethanol
8	Glycine-OMe	Ethanol	Saturated solution of gly-OMe in ethanol
9	Vanillin	Ethanol	Saturated solution of vanillin in ethanol
10	Glucose	Ethanol	Saturated solution of glucose in ethanol
11	Mannitol	Ethanol	Saturated solution of mannitol in ethanol
12	NaCl	Ethanol	Saturated solution of NaCl in ethanol
13	boc-Glycine	THF	Saturated solution of boc-Gly in THF
14	Glycine-OMe	THF	Saturated solution of gly-OMe in THF
15	Vanillin	THF	Saturated solution of vanillin in THF
16	Glucose	THF	Saturated solution of Glucose in THF
17	Mannitol	THF	Saturated solution of mannitol in THF
18	NaCl	THF	Saturated solution of NaCl in THF

According to the table entries, solid was added to 1.5 mL eppendorf tubes and 500 uL of solvent added. Each tube was then vortexed for 30 seconds. The tubes were examined and to those tubes where the solid had completely dissolved (boc-Gly and vanillin) further solid was added followed by 30s vortexing until residual solid was observed.

The full log of the experiment is available at:

http://usefulchem.wikispaces.com/exp207